Introduction

Assigning storage locations to your items is a much needed part of organizing your lab. Simply click “Locations” under “Inventory” on the menu and select “Create New Location”. You may then add the name of your location where you can include details such as storage temperature. Of course, you are able to change the name of the location should you wish to do so later on.

Adding Storage Locations

• Step 1 - Let's name our first location “PCR Reagents Room” and click “Add New Location”.
• 
• Step 2 - We will then repeat this process again and create our second location named “Extraction Reagents Room”.
• 
• Step 3 - Your list of locations should look similar to the following image.
• 

Adding Extraction Reagents

• Step 1 - The QIAmp Fast DNA Stool Mini Kit (Cat#51604) contains 6 reagents but requires ethanol (96-100%) from the user.
• 
• 
• Step 2 - Knowing this, let us first lets add InhibitEX Buffer. To do so, click on “Inventory” and select “Reagents”. Click on “Add New Reagent”, set the Name as “InhibitEX Buffer”, Brand as Qiagen, and the Lot Number on the container. If you do have the item on hand then enter the lot number shown, or else set the lot number as “L12341234”.
• Step 3 - Set the Catalog Number as “51604” and Usage as “EXTRACTION”. Set the Volume Storage and Volume Unit accordingly to what you currently have. In this case, the kit contains 140 milliliters of InhibitEx Buffer. So we will set the volume as “140” and the volume unit as “mL”.
• Step 4 - Leave the remaining fields empty (as they are only relevant for reagents used in PCR) except for the Expiration Date and Location. Keep in mind that these two fields are optional but it is highly recommended for time-sensitive products to have an assigned expiration date as well as a storage location to encourage organization in your lab.
• Step 5 - In this case, we will leave the Expiration Date empty but set the location to “Extraction Reagents Room”. Note that we will be assigning this location to all extraction reagents as a demonstration. Ideally, each of these reagents require different storage conditions.
• Step 6 - Once everything has been confirmed, click “Add Reagent”.
• 
• Step 7 - We will do this exact same process for Buffer AL, Buffer ATE, Proteinase K, and 1L of ethanol. The ethanol will have the Name “Ethanol”, Brand as “Generic”, and Catalog Number as “C12341234”.
• 
• 
• 
• 
• Step 8 - Once we get to adding Buffer AW1 and Buffer AW2, you will notice how these reagents are supplied as concentrates. Keep in mind that Qiagen instructs you to add 25 mL of ethanol to the concentrate volume of 19 mL. So when adding this reagent to the system, set the Volume Stored as the total volume of 44 mL. For Buffer AW2, we will set the Volume Stored as the total volume of 43 mL.
• 
• 
• Step 9 - In the reagents page, set Usage to “EXTRACTION” and you should see that your list of reagents should look similar to the following image.
• 

Adding PCR General Reagents

• Step 1 - Let's now add reagents for PCR. To do so, we will refer to the master mix of a generic assay presented by INTEGRA
• 
• Step 2 - Let's add each reagent from top to bottom starting with Buffer. We will follow the same process by clicking on “Add New Reagent”, assign Name as “Buffer”, Brand as “Generic”, Lot Number as “L12341234” and Catalog Number as “C12341234”.
• Step 3 - For Usage, we will leave it as “PCR” and for the PCR Reagent Type we will set it as “General” since it is neither a primer, polymerase, or water/diluent.
• Step 4 - The Forward and Reverse Sequence is irrelevant in this case so we will leave them blank.
• Step 5 - Let's set the Volume Stored as “500” and the Volume Unit as “µL”.
• Step 6 - The stock concentration of Buffer is “10X” so we will set the Stock Concentration to 10 and the Concentration Unit as “X”.
• Step 7 - We will leave the Expiration Date empty and set the location to “PCR Reagents Room” for all PCR reagents.
• 
• Step 8 - We will repeat this exact process for 100µL magnesium chloride and 100µL dNTP's.
• 
• 

Adding PCR Primer Reagents

• Step 1 - To handle adding the Forward Primer, we will set the Name as “Forward Primer 1”, Brand as “Generic”, Lot Number as “L12341234” and Catalog Number “C12341234”.
• Step 2 - Set the PCR Reagent Type as “Primer” and since this reagent only contains the forward primer we will set the Forward Sequence as “ATGGCTAAAGGGGTTTATAT”. Note that the Forward and Reverse Sequence is not required but is recommended for the sake of organization.
• Step 3 - For the Volume we will set that as “100” and the Volume Unit as “µL”.
• Step 4 - The Stock Concentration will be “10” and the Concentration Unit as “µM”.
• 
• Step 5 - We will repeat this process for the Reverse Primer where instead of adding a sequence for the Forward Sequence we will instead assign “TTTGGAACAACGGTAAGTTC” as the Reverse Sequence.
• 

Adding PCR Polymerase Reagents

• Step 1 - To add the Polymerase we will set the Name as “Polymerase”, Brand as “Generic”, Lot Number as “L12341234” and Catalog Number as “C12341234”.
• Step 2 - The Usage remains as “PCR” and the PCR Reagent Type will be “Polymerase”.
• Step 3 - Keep in mind that setting PCR Reagent Type to “Polymerase” is only needed if your polymerase is in the units of “U/µL”. If you polymerase comes as a mixture of other reagents such as dNTP's and has a concentration in moles, then set PCR Reagent Type as “General”.
• Step 4 - This is important to keep note as “Polymerase” reagents follow a different calculation in the master mix.
• Step 5 - We will set the Volume as “100” and Volume Unit as “µL”.
• Step 6 - Stock Concentration will be “5” and Concentration Unit as “U/µL”.
• 

Adding PCR Water/Diluent Reagents

• Step 1 - To add water, set the Name as “Water”, Brand as “Generic”, Lot Number as “L12341234” and Catalog Number as “C12341234”.
• Step 2 - The Usage is “PCR” and the PCR Reagent Type is “Water”.
• Step 3 - We will then set the Volume as “1” and the Volume Unit as “L”.
• Step 4 - Since water has no stock concentration, leave Stock Concentration and Concentration Unit empty.
• 
• Step 5 - On the Reagents page, set the Usage to “PCR” and your inventory should look similar to the following image.
• 

Introduction

Tubes are a necessity in all steps of PCR. Take note that PCRprep only keeps track of the usage of tubes for extraction. Which is why tubes are required to create your extraction protocols. To add tubes click on “Inventory” on the menu, select “Tubes", and click on “Add New Tubes”. Let's refer back to the QIAmp Fast DNA Stool Mini Kit as it contains tubes to add to the system.

Adding Tubes

• Step 1 - Let us refer back to the QIAmp Fast DNA Stool Mini Kit containing 50 QIAmp Mini spin columns and 500 2ml Collection Tubes.
• Step 2 - To add the QIAmp Mini spin columns, click on “Add New Tube”, set Name to “QIAmp Mini spin columns”, Brand as “Qiagen”, and Lot Number as “L12341234” or the actual lot number should you have the product at hand.
• Step 3 - The Catalog Number is “51604” and the Amount is 50.
• Step 4 - We will leave the Expiration Date empty, set the location to “Extraction Reagents Room” and click “Create New Tube”.
• 
• Step 5 - We will repeat this exact process adding the 200 2ml Collection Tubes in the kit, as well as adding 1000 1.7 ml Generic centrifuge tubes.
• 
• 
• Step 6 - Your list of tubes should look similar to the following image.
• 

Introduction

Plates are required for PCR and is a necessary part of processing your samples. To create a plate click on “Inventory” and select “Plates”. There you will be able to select “Add New Plate” and assign each field accordingly. In our case, we will require two types of plates; plates for PCR and plates for qPCR.

Adding PCR Plates

• Step 1 - The first plates we will add are 50 96-well plates for PCR. To do so, click on “Add New Plate”, set the Name as “96W Plate”, Brand as “Generic”, Lot Number as “L12341234”, and Catalog Number as “C12341234”.
• Step 2 - The Size will be “96”, the Type is “PCR” and the Amount Stored is 50.
• Step 3 - We will leave the the Expiration Date and Location empty.
• 
• Step 4 - We will now repeat the same process in adding 50 48-well plates for PCR where the only difference will be setting the Size to “48”.
• 

Adding qPCR Plates

• Step 1 - Adding plates for qPCR is very similar to adding plates for PCR. The only difference is to set the Type as “qPCR”.
• Step 2 - We will be adding 50 96-well plates for qPCR and 50 48-well plates for qPCR.
• 
• 
• Step 3 - Your list of plates should look similar to the following image.
• 

Introduction

Gels are required for PCR analysis. If you are processing samples for PCR (not qPCR) then you will most likely need gels to view your results. To add a gel, click on “Inventory” and select “Gels”. You can click on “Add New Gel”. In our case, we will add 50 24-well gels.

Adding Gels

• Step 1 - To add our 24-well gels we must first select “Add New Gel”, set Name as “24W Gels”, Brand as “Generic”, Lot Number as “L12341234”, and Catalog Number as “C12341234”.
• Step 2 - We will keep the size as 24 and the Storage Amount as 50.
• Step 3 - We will leave the Expiration Date and Location empty.
• 
• Step 4 - Your list of gels should look similar to the following image.
• 

Introduction

Ladders are an essential part of reading your results in a gel for PCR. To add your ladders click on “Inventory” on the menu, select “Ladders”, and click on “Add New Ladder”. For this tutorial we will be adding 100µL of 100bp Low Ladder.

Adding Ladders

• Step 1 - To add a Ladder, click on “Add New Ladder”, set Name as “100bp Low Ladder”, Brand as “Generic”, Lot Number as “L12341234”, and Catalog Number as “C12341234”.
• Step 2 - Set the Amount Stored (µL) as 100.
• Step 3 - We will leave the Expiration Date and Location empty.
• 
• Step 4 - Your list of ladders should look similar to the following image.
• 

Introduction

Loading Dyes are another essential part of reading results in a gel for PCR. To add dyes, click on “Inventory”, select “Dyes”, and click on “Add New Dye”. In this situation we will add 100µL DNA Gel Loading Dye.

Adding Dyes

• Step 1 - To add dyes, click on “Add New Dye”, set Name as “DNA Gel Loading Dye”, Brand as “Generic”, Lot Number as “L12341234”, and Catalog Number as “C12341234”.
• Step 2 - We will set the Amount Stored (µL) as 100.
• Step 3 - We will leave the Expiration Date and Location empty.
• 
• Step 4 - Your list of dyes should look similar to the following image.
•